View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6589_high_1 (Length: 302)
Name: NF6589_high_1
Description: NF6589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6589_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 123 - 288
Target Start/End: Complemental strand, 33562651 - 33562485
Alignment:
| Q |
123 |
attcatatatgcctaatgtcttaggacctgttgttaggtttaaaggttgaatagttaagtagctctctagtatccatgnnnnnnn-ggcaaggagtgaga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||||||||||| ||||||||||| || |
|
|
| T |
33562651 |
attcatatatgcctaatgtcttaggacctgttgttgggtttaaaggttgaatagttaagaagttcactagtatccatgttttttttggcaaggagtggga |
33562552 |
T |
 |
| Q |
222 |
aggttggttattctagtatgacattaacatgttgattgagtgatttaaccaacatacttgttggaga |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33562551 |
aggttggttattctagtatgacattaacatgttgattgagtgatctaaccaacatacttgttggaga |
33562485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 52
Target Start/End: Complemental strand, 8269321 - 8269292
Alignment:
| Q |
23 |
gtgtttgagcccattccaagcagagttgtt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8269321 |
gtgtttgagcccattccaagcagagttgtt |
8269292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University