View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6590_low_2 (Length: 392)
Name: NF6590_low_2
Description: NF6590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6590_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 4 - 384
Target Start/End: Original strand, 15359184 - 15359564
Alignment:
| Q |
4 |
aacaccaaaaattgtaattctaaaggttttaatttggcacagttgcacaacacatgcagctagtaaagaagtaagatcgcgatttgcgcttttcttttcc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15359184 |
aacaccaaaaattgtaattctaaaggttttaatttggcacagttgcacaacacatgcagctagtaaagaagtaagatcgcgatttgcgcttttcttttcc |
15359283 |
T |
|
| Q |
104 |
tttaggtgaagtatacgacacttccttcacttcaatcattgaaccagcattgatatcttgtgtctgttccatgactagaacatgagcttcttcttctttt |
203 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15359284 |
tttaggtgaagtagacgacacttccttcacttcaatctttgaaccaacatttatatcttgtgtctgtgccatgactagaacatgagcttcttcttctttt |
15359383 |
T |
|
| Q |
204 |
aagaaaccaatgaatgaagctttagatatctccgagtaacttctttccatagtaactattttctcttcaatgagaccatgctcatcatgagacattgagt |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15359384 |
aagaaaccaatgaatgaagctttagatatctccgagtaacttctttccatagtaactattttctcttcaatgagaccatactcatcatgagacattgagt |
15359483 |
T |
|
| Q |
304 |
tgctgatatttagacttgccttgtttgacaagttatcatctgaagacttatcaagcaatggaatttgatccgattcttctc |
384 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15359484 |
tgctgatatttagacttgccttgtttggcaagctatcatctgaagacttatcaagcaatggaatttgatccgattcttctc |
15359564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University