View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6590_low_7 (Length: 244)
Name: NF6590_low_7
Description: NF6590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6590_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 15359159 - 15358934
Alignment:
| Q |
1 |
tctggaagtgaagttttgatgtggagaggatattgatcggtatatggtccggcttcaagtctgttgtaatgctcttctgaggtattgtccgtttttggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15359159 |
tctggaagtgaagttttgatgtggagaggatattgatcggtatatggtccggcttcaagtctgttgtaatgctcttctgaggtattgtccgtttttggtg |
15359060 |
T |
|
| Q |
101 |
ttatttaaatcattgcggttttgtggaatggggagagtgaatgcttataactatttttagtttcgatttctaaagcaatgtgagattttttgatgtacag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15359059 |
ttatttaaatcattgcggttttgtggaatggagagagtgaatgcttataactatttttagtttcgatttctaaagcaatgtgagattttttgatgtacag |
15358960 |
T |
|
| Q |
201 |
aaagtcgggaggaatatcatacggtc |
226 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
15358959 |
aaagtcgggacgaatatcatacggtc |
15358934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University