View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6590_low_8 (Length: 239)
Name: NF6590_low_8
Description: NF6590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6590_low_8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 39 - 239
Target Start/End: Complemental strand, 36083809 - 36083609
Alignment:
| Q |
39 |
aaaattattcacatttattatattcaagattttttcatccattataaataatgtttgtttgagaaattgcataggagattgagggtttcacagatccaaa |
138 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36083809 |
aaaattattcacatttgttatattcaagattttttcatccattataaataatctttgtttgagaaattgcataggagattgagggtttcacagatccaaa |
36083710 |
T |
 |
| Q |
139 |
gaggaaggatgttgcaatagttagaaagaggatagacatggtaaacaaagagttgaagccattgggtcaaacctgccagaaaaaggttagattttccaac |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36083709 |
gaggaaggatgttgcaatagttagaaagaggatagacatggttaacaaagagttgaagccattgggtcaaacctgccagaaaaaggttagattttccaac |
36083610 |
T |
 |
| Q |
239 |
t |
239 |
Q |
| |
|
| |
|
|
| T |
36083609 |
t |
36083609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University