View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6592_high_6 (Length: 304)
Name: NF6592_high_6
Description: NF6592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6592_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 25 - 170
Target Start/End: Original strand, 56311749 - 56311894
Alignment:
| Q |
25 |
tgttgttgttagttagttagagagagtggatggcaatagcagccgcaacatcatcacctaacatgagcagcatgagcttgagtcacgaagatggaacttc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311749 |
tgttgttgttagttagttagagagagtggatggcaatagcagcagcaacatcatcacctaacatgagcagcatgagcttgagtcacgaagatggaacttc |
56311848 |
T |
|
| Q |
125 |
taacgataatattaacaaaggagctacagctacagttacagtagta |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311849 |
taacgataatattaacaaaggagctacagctacagttacagtagta |
56311894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 192 - 304
Target Start/End: Original strand, 56311922 - 56312034
Alignment:
| Q |
192 |
cacgagcatgacgtggttatgccagggtttcgtttccatccaactgaagaagaacttgtagagttctaccttcgccgtaaggtcgagggaaaacgtttca |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311922 |
cacgagcatgacgtggttatgccagggtttcgtttccatccaactgaagaagaacttgtagagttctaccttcgccgtaaggtcgagggaaaacgtttca |
56312021 |
T |
|
| Q |
292 |
acgttgagcttat |
304 |
Q |
| |
|
||||||||||||| |
|
|
| T |
56312022 |
acgttgagcttat |
56312034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 250
Target Start/End: Original strand, 8449724 - 8449761
Alignment:
| Q |
213 |
ccagggtttcgtttccatccaactgaagaagaacttgt |
250 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
8449724 |
ccagggtttcgtttccacccaactgatgaagaacttgt |
8449761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University