View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6592_high_8 (Length: 257)
Name: NF6592_high_8
Description: NF6592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6592_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 35037805 - 35038039
Alignment:
| Q |
1 |
ttcctatagagtccaagtttttggttggaggcttctttcaaaacttcctataccatatatcaattaatcaatgagttttatggggcccatagaatgtgtg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037805 |
ttcctataaagtccaagtttttggttggagacttctttcaaaacttcctataccatatatcaattaatcaatgagttttatggggcccatagaatgtgtg |
35037904 |
T |
 |
| Q |
101 |
tgctctttacttnnnnnnnnnnnntaataataaatcatcttcttagtgaatttagggcgggaaagtcatcatgacattaacaaaattttgagtgttttat |
200 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35037905 |
tgctctttacttaaaaaaa------aacaataaatcatcttcttagtgaatttagggcgggaaagtcatcatgacattaacataattttgagtgttttat |
35037998 |
T |
 |
| Q |
201 |
gagagaaataatctcatcttctattgttgttatgaggtgaa |
241 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35037999 |
gagagaaataatctcatcgtctattgttgttatgaggtgaa |
35038039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University