View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6592_low_10 (Length: 259)
Name: NF6592_low_10
Description: NF6592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6592_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 104 - 241
Target Start/End: Original strand, 35903229 - 35903366
Alignment:
| Q |
104 |
tcctactttattttctgtgaacaactaaatatcctactagtcatctacacaaactaaaaattgaaaacgnnnnnnnggatgaaaaaagttttaaagctta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35903229 |
tcctactttattttctgtgaacaactaaatatcctactagtcatctacacaaaataaaaattgaaaacgtttttttggatgaaaaaagttttaaagctta |
35903328 |
T |
 |
| Q |
204 |
aaacgtgaaaccctaagtgttcaattgatgtatttttt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35903329 |
aaacgtgaaaccctaagtgttcaattgatgtatttttt |
35903366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University