View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6592_low_11 (Length: 257)

Name: NF6592_low_11
Description: NF6592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6592_low_11
NF6592_low_11
[»] chr6 (1 HSPs)
chr6 (1-241)||(35037805-35038039)


Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 35037805 - 35038039
Alignment:
1 ttcctatagagtccaagtttttggttggaggcttctttcaaaacttcctataccatatatcaattaatcaatgagttttatggggcccatagaatgtgtg 100  Q
    |||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35037805 ttcctataaagtccaagtttttggttggagacttctttcaaaacttcctataccatatatcaattaatcaatgagttttatggggcccatagaatgtgtg 35037904  T
101 tgctctttacttnnnnnnnnnnnntaataataaatcatcttcttagtgaatttagggcgggaaagtcatcatgacattaacaaaattttgagtgttttat 200  Q
    ||||||||||||             || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
35037905 tgctctttacttaaaaaaa------aacaataaatcatcttcttagtgaatttagggcgggaaagtcatcatgacattaacataattttgagtgttttat 35037998  T
201 gagagaaataatctcatcttctattgttgttatgaggtgaa 241  Q
    |||||||||||||||||| ||||||||||||||||||||||    
35037999 gagagaaataatctcatcgtctattgttgttatgaggtgaa 35038039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University