View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6592_low_12 (Length: 244)
Name: NF6592_low_12
Description: NF6592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6592_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 6 - 243
Target Start/End: Complemental strand, 11243988 - 11243751
Alignment:
| Q |
6 |
gatggacatcatcaccgcacttgcagcgttacatctctacaatcttccaaacattaaagttattctacgaaggaggtttcatacctcccaagttacgagc |
105 |
Q |
| |
|
|||||||| | |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11243988 |
gatggacaccctcaccgcacttgtagcgttatatctctacaatcttccaaacattaaagttattctacgaaggaggtttcatacctcccaagttacgagc |
11243889 |
T |
 |
| Q |
106 |
attttgttttgtttccgtgagaataacaaagccagtaacagaatggggtctccaaggccttactactctgtcatcaatgaatatcggaggcgatgatatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11243888 |
attttgttttgtttccgtgagaataacaaagccagtagcagaatggtgtctccaaggccttactactctgtcatcaatgaatatcggaggcgatgatatt |
11243789 |
T |
 |
| Q |
206 |
gttaactcgttgctcaaggagcagctgcttcccatttc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11243788 |
gttaactcgttgctcaaggagcagctgcttcccatttc |
11243751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 17850253 - 17850212
Alignment:
| Q |
140 |
gtaacagaatggggtctccaaggccttactactctgtcatca |
181 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
17850253 |
gtaacagaatggggtctccaaggcctaactgctctttcatca |
17850212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University