View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6593_low_12 (Length: 258)
Name: NF6593_low_12
Description: NF6593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6593_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 47075651 - 47075880
Alignment:
| Q |
19 |
catcccaatctggacgtctttgatcaccaaacagaagcttttcaagtgatccgttgctcatgtattcataaaccaaaagcctttttgaaccctcatgaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47075651 |
catcccaatctggacgtctttgatcaccaaacagaagcttttcaagtgatccgttgctcatgtattcataaaccaaaagcctttttgaaccctcatgaca |
47075750 |
T |
 |
| Q |
119 |
aaaacccagcaatctaactaggttcctgtggtgggttttcccaatggatctcacttctgcttgaaattccctttccccatcttccaccaccttctctagt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47075751 |
aaaacccagcaatctaactaggttcctgtggtgggttttcccaatggatctcacttctgcttgaaattccctttccccatcttccaccaccttctctagt |
47075850 |
T |
 |
| Q |
219 |
ctcttcactgcaatcaatctcttacctttg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47075851 |
ctcttcactgcaatcaatctcttacctttg |
47075880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 23 - 248
Target Start/End: Complemental strand, 47068675 - 47068450
Alignment:
| Q |
23 |
ccaatctggacgtctttgatcaccaaacagaagcttttcaagtgatccgttgctcatgtattcataaaccaaaagcctttttgaaccctcatgacaaaaa |
122 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
47068675 |
ccaatctgggcgtctttgatcaccaaaaagaagctttccaagtgatccgttgctcatgtattcataaaccagaagcctttttgaaccctcaacacaaaaa |
47068576 |
T |
 |
| Q |
123 |
cccagcaatctaactaggttcctgtggtgggttttcccaatggatctcacttctgcttgaaattccctttccccatcttccaccaccttctctagtctct |
222 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||| || |||||||||| |
|
|
| T |
47068575 |
ccaagcaatctaactaggttcctgtggtgggttttcccaatggatctcacttctgcttgaaattccttttcaccttcttccaccactttttctagtctct |
47068476 |
T |
 |
| Q |
223 |
tcactgcaatcaatctcttacctttg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47068475 |
tcactgcaatcaatctcttacctttg |
47068450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University