View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6593_low_9 (Length: 406)
Name: NF6593_low_9
Description: NF6593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6593_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 357; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 19 - 395
Target Start/End: Complemental strand, 6315231 - 6314855
Alignment:
| Q |
19 |
attttgctgctttttcttttgccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagctgcttacttcttctctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315231 |
attttgctgctttttcttttgccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagctgcttacttcttctctt |
6315132 |
T |
 |
| Q |
119 |
ccatatattccacaacaccatagttaaaccattcataatcattgttgtgcagttgttgatgacagtaaaaataaactctgcacatgatgaaaatgtcccc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6315131 |
ccatatattccacaacaccatagttaaaccattcataatcattgttgtgcagttgttgatgacagtaaaaataaattctgcacatgatgaaaatgtcccc |
6315032 |
T |
 |
| Q |
219 |
tgcatgcgtttgaatttgaggtcataggtcactattcccctaagctgttgtagtttcttgccattcaaagaagatatgccttaggaggtgctgtgtgtag |
318 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315031 |
tgcatgcgtttgaatttgaggtcataggttactattcccctaagctgttgtagtctcttgccattcaaagaagatatgccttaggaggtgctgtgtgtag |
6314932 |
T |
 |
| Q |
319 |
gaagggaaagagtgacttctgtccctttttgcaatccacttgtgtgcttttaattccctaacggtcacaggttctgc |
395 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6314931 |
gaagggaaagagtgacttctggccctttttgcaatccacttgtgtgcttttaattccctaacagtcacaggttctgc |
6314855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 146 - 296
Target Start/End: Complemental strand, 6318236 - 6318086
Alignment:
| Q |
146 |
accattcataatcattgttgtgcagttgttgatgacagtaaaaataaa--ctctgcacatgatgaaaatgtcccctgcatgcgtttgaatttgaggtcat |
243 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||| |||| |||| |||||||||||| || ||| ||| ||||||||||| ||||||| |
|
|
| T |
6318236 |
accattcataatccttgttgtgcagctgttgatgacagtaaaattaaattctctccacatgatgaaactg--acctacatacgtttgaatttaaggtcat |
6318139 |
T |
 |
| Q |
244 |
aggtcactattcccctaagctgttgtagtttcttgccattcaaagaagatatg |
296 |
Q |
| |
|
| ||||||| | || || || || ||| ||||| |||||||| |||||||| |
|
|
| T |
6318138 |
atttcactatactcccaaacttttatagcctcttggcattcaaacaagatatg |
6318086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University