View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_106 (Length: 211)
Name: NF6594_high_106
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_106 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 1382789 - 1382615
Alignment:
| Q |
17 |
aaaatattagccattcttttatcatagtgacttcttctaacattccaaaatgaagtaggttatagaagacaaacgaattatgagtcattttaataagata |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
1382789 |
aaaatattagtcattcttttatcatagtgacttcttctaacatttcaaaatgaagtaggttatagaagacaaacgaattatgtgtcattttaataa-ata |
1382691 |
T |
|
| Q |
117 |
attaattgtacaacttttattgggggaaacattttctttcttcttttttaagacaaaaataaaataaagagagaaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1382690 |
attaattgtacaacttttattgggggaaacattttctttcttcttttttaagacaaaaataaaataaagagagaaa |
1382615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University