View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_42 (Length: 342)
Name: NF6594_high_42
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 7e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 101 - 190
Target Start/End: Complemental strand, 27253878 - 27253791
Alignment:
| Q |
101 |
acaaacttttgcaaccctttaaatacaacaatcttagtataaacatttctcatacacactcacaccctcttttctcttcctcaatattcc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27253878 |
acaaacttttgcaaccctttaaatacaacaatcttagtataaacatttctcat--acactcacaccctcttttctcttcctcaatattcc |
27253791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 221 - 326
Target Start/End: Complemental strand, 27253766 - 27253661
Alignment:
| Q |
221 |
tgatgacttctcttactactactttaaagcttttannnnnnnatgtgatttttgtcctcccaattcttgtttcatgtgattcatgcaaatgtgaaactga |
320 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27253766 |
tgatgagttctcttactactaccttaaagcttttatttttttatgtgatttttatcctcccaattcttgtttcatgtgattcatgcaaatgtgaaactga |
27253667 |
T |
|
| Q |
321 |
acaaac |
326 |
Q |
| |
|
|||||| |
|
|
| T |
27253666 |
acaaac |
27253661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University