View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_48 (Length: 331)
Name: NF6594_high_48
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 8e-89; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 155 - 324
Target Start/End: Complemental strand, 4175465 - 4175296
Alignment:
| Q |
155 |
gtagtatcttattttagatatttatcattattggtttttgtcattgttacaataaatatttatgaaatgtatgggctattgtgcagccaagagttgcgtg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4175465 |
gtagtatcttattttagatatttatcattattggtttttgtcattgttacaacaaatatttatgaaatgtatgggctattgtgcagccaagagttgcgtg |
4175366 |
T |
|
| Q |
255 |
cagtggagaggagggtacttttggaaaccttggctggacaactgcctacggataccattcaatattcttc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4175365 |
cagtggagaggagggtacttttggaaaccttggctggacaactgcctacggataccattcaatattcttc |
4175296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 45 - 137
Target Start/End: Complemental strand, 4175843 - 4175751
Alignment:
| Q |
45 |
taggaattgagaccaagaagaatgttatcggcactctctttctaacaatagaatagtccctaacaacatacattgcttatgaatttcatagaa |
137 |
Q |
| |
|
||||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4175843 |
taggaattgagactaagaagagtgttatcgacactctctttctaacaatagaatagtccctaacaacatacattgcttatgaatttcaaagaa |
4175751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 209 - 324
Target Start/End: Complemental strand, 4171423 - 4171306
Alignment:
| Q |
209 |
aatatttatgaaatgtat--gggctattgtgcagccaagagttgcgtgcagtggagaggagggtacttttggaaaccttggctggacaactgcctacgga |
306 |
Q |
| |
|
||||||||||||||| || ||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||| || | ||| | || |
|
|
| T |
4171423 |
aatatttatgaaatgcataaggggtattgtgcagccaagaggtgcgtgcagtggagaggagagtacttttggaaactttggctgctcagttacctcctga |
4171324 |
T |
|
| Q |
307 |
taccattcaatattcttc |
324 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
4171323 |
tagcattcaatattcttc |
4171306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University