View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_49 (Length: 310)
Name: NF6594_high_49
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 11 - 293
Target Start/End: Original strand, 4197982 - 4198264
Alignment:
| Q |
11 |
agaatatgtagtactaatttcagataatttcaaatttcataatagaaaactgtccctacatttggaatctgtagttaaaccatgctcaaacgctgatgaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4197982 |
agaatatgtagtactaatttcagataatttcaaatttcataatagaaaactgtccctacatttggaatctgtagttaaaccatgctcaaacgctgatgaa |
4198081 |
T |
 |
| Q |
111 |
tttttggatgtttccagtttaaattctttgactgccatatacgtgaaaatttacatcttgcagtgctatcagatatgtgctgggtacagctatgagaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4198082 |
tttttggatgtttccagtttaaattctttgactgccatatacgtgaaaatttacatcttgcagtgctatcagatatgtgctgggtacagctatgagaaaa |
4198181 |
T |
 |
| Q |
211 |
atgagttaatgaggtagttaggcagacactgcccttcctggtcccttgtttaaatgcaggttccatccatgtgtgttgatagt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4198182 |
atgagttaatgaggtagttaggcagacactgcccttcctggtcccttgtttaaatgcaggttccatccatgtgtgttgatagt |
4198264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University