View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_51 (Length: 307)
Name: NF6594_high_51
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 7 - 166
Target Start/End: Complemental strand, 1459017 - 1458856
Alignment:
| Q |
7 |
aaattattctcaagttcaagggcgtctgcaacatgtaaactctcggtttattcggaacaatatgattaagtaagcaagtagtagtttctctatt--ctct |
104 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
1459017 |
aaattattctcaagttcaagggtgtctgcaacatgtaaactctcggtttatttggaacaatattattaagtaagcaagtagtagtttctctattctctct |
1458918 |
T |
 |
| Q |
105 |
attgtttcattaattttatatttgaattactagacaccaagcaagcactttaatcattagtg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1458917 |
gttgtttcattaattttatatttgaattactagacacaaagcaagcactttaatcattagtg |
1458856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 279 - 307
Target Start/End: Complemental strand, 1458330 - 1458302
Alignment:
| Q |
279 |
gtggaagcctttgagggtcacagaaaaca |
307 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1458330 |
gtggaagcctttgagggtcacagaaaaca |
1458302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University