View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_59 (Length: 277)
Name: NF6594_high_59
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_59 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 14 - 277
Target Start/End: Complemental strand, 8458571 - 8458308
Alignment:
| Q |
14 |
accttattaatcagtaacctttaaacctaaatatcccttctattccttaatatttcaattcacatagcaaaatttatttccaaatgcaaaattaatttta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458571 |
accttattaatcagtaacctttaaacctaaatatcccttctattccttaatatttcaattcacatagcaaaatttatttccaaatgcaaaattaatttta |
8458472 |
T |
|
| Q |
114 |
cataaatcaattataccataaccaggcttgtagtttccatacgaaataagaaaaatgcatataaatttgcgctgaccatacacacccccacttgagcatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8458471 |
cataaatcaattataccataaccaggcttgtagtttccatacgaaataagaaaaatgcatataaagttgcgctgaccatacacacccccacttgagcatg |
8458372 |
T |
|
| Q |
214 |
tatttcagtgtgttattttgagaaatagtgaactaagaacctgagttgagccagtatcatgatt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8458371 |
tatttcagtgtgttattttgagaaatagtgaactaaaaacctgagttgagccagtatcatgatt |
8458308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University