View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_61 (Length: 272)
Name: NF6594_high_61
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_61 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 119 - 255
Target Start/End: Complemental strand, 44043175 - 44043039
Alignment:
| Q |
119 |
cctttttgcggagaccagaggttccaggcttctgtccatcgaaaggagtagtttcaatacgggagacattgaagagcaccatggttgattgattacctga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44043175 |
cctttttgcggagaccagaggttccaggcttctgtccatcgaaaggagtagtttcaatacgggagacattgaagagcaccatggttgattgattacctga |
44043076 |
T |
|
| Q |
219 |
ttgaagaaaaacgaaatctaagagtttcagagagaga |
255 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44043075 |
ttgaagaaaaacgaaatctaaaagtttcagagagaga |
44043039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University