View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_70 (Length: 254)
Name: NF6594_high_70
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_70 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 14 - 126
Target Start/End: Original strand, 8751631 - 8751743
Alignment:
| Q |
14 |
tggataagggaaaaagaatttgccccactgctctagtttatactattttctctctcagtccttaaactacgaaacaaaagattttgataaataaagtaac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8751631 |
tggataagggaaaaagaatttgccccactactctagtttatactattttctctctcagtccttaagctacgaaacaaaagattttgataaataaagtaac |
8751730 |
T |
 |
| Q |
114 |
gtatatgccatgc |
126 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
8751731 |
gtatatgtcatgc |
8751743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 149 - 243
Target Start/End: Original strand, 8751779 - 8751873
Alignment:
| Q |
149 |
gcttgcacatggtttatacgctggtgtagtagttaaagggcttatatacatactgtatgatgtagttgtgacgatttgatagatcacctttgctt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8751779 |
gcttgcacatggtttatacgctggtgtagtagttaaagggcttatatacatactgtatgatgtagttgtgacgatttgatagatcacctttgctt |
8751873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University