View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_75 (Length: 251)
Name: NF6594_high_75
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_75 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 24119002 - 24119242
Alignment:
| Q |
11 |
agaatatcaagccggaggataacggctgcgtcgccgggccgtggaggaagtaagaactcacacataaggaaaacaagaagtgctcaattgaagattgatt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24119002 |
agaaaatcaagccggaggataacggctgcgtcgccgggccgtggaggaagtaagaactcacacataaggaaaacaagaagtgctcaattgaagattgatt |
24119101 |
T |
|
| Q |
111 |
ttgatgagttgggtagtggtgctgctcttagtcgtgcttcaagtgccagcttgggtctctcatttggattcactggtttcactatgcctcctgatcaaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24119102 |
ttgatgagttgggtagtggtgctgctcttagtcgtgcttcaagtgccagcttgggtctctcatttggcttcactggtttcactatgcctcctgatcaaat |
24119201 |
T |
|
| Q |
211 |
tgctgataccaaaccatttagtgatgatgatatgattcgta |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24119202 |
tgctgataccaaaccatttagtgatgatgatatgattcgta |
24119242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University