View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_81 (Length: 242)
Name: NF6594_high_81
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_81 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 32760535 - 32760760
Alignment:
| Q |
17 |
attatcacaccatgaaactaatcataaatttttcttccactattttccttttgtttactacttccatatccgcttacacattttcagatcatatctcacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32760535 |
attatcacaccatgaaactaatcataaatttttcttccactattttccttttgtttactacttccatatccgcttacacattttcagatcatatctcacc |
32760634 |
T |
|
| Q |
117 |
gaatttcactgcttcgtatcttcaattcatcgctaacaccggaacatttttgttgtctagaaacaaaacattcaaggcagctatattcaatcctggtaat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32760635 |
gaatttcactgcttcgtatcttcaattcatcgctaacactggaacatttttgttgtctagaaacaaaacattcaaggcagctatattcaatcctggtaat |
32760734 |
T |
|
| Q |
217 |
caacaaacaagtttctatctatgcat |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32760735 |
caacaaacaagtttctatctatgcat |
32760760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University