View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_89 (Length: 238)
Name: NF6594_high_89
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_89 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 45313774 - 45313573
Alignment:
| Q |
20 |
ctgaggatattaacatgattgatgttgagggaaataagtcaagtcaagtcaagaggaggagattatggaaatttctagaatgcgcaagggtccggtgttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45313774 |
ctgaggatattaacatgattgatgttgagggaaataagtcaagtcaag-----aggaggagattatggaaatttctagaatgcgcaagggtccggtgttg |
45313680 |
T |
 |
| Q |
120 |
gatttgatgccgctcttctttcgagaaagaaactgcaaatgaaagggggtccagggaggataaggagaaggagacggttactgtttttgatattaaccta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45313679 |
gatttgatgccgctcttctttcgagaaagcaactgcaaatgaaagggggtccggggaggataaggagaaggagacggttactgtttttgatattaaccta |
45313580 |
T |
 |
| Q |
220 |
tgatgat |
226 |
Q |
| |
|
||||||| |
|
|
| T |
45313579 |
tgatgat |
45313573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 131 - 191
Target Start/End: Original strand, 54631733 - 54631793
Alignment:
| Q |
131 |
gctcttctttcgagaaagaaactgcaaatgaaagggggtccagggaggataaggagaagga |
191 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
54631733 |
gctcttctttcgagaaagcgactgcaaatgaaagggggtctggggaggataaggataagga |
54631793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 54631688 - 54631729
Alignment:
| Q |
20 |
ctgaggatattaacatgattgatgttgagggaaataagtcaa |
61 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||| ||||||| |
|
|
| T |
54631688 |
ctgaggatgttaacatggttgatgttgagggaaacaagtcaa |
54631729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University