View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_91 (Length: 237)
Name: NF6594_high_91
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_91 |
 | |
|
| [»] scaffold0262 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 42373054 - 42372842
Alignment:
| Q |
16 |
accaatcactgtcgctcgctccactatatctgtttaaggtcagtttccgccccttgctatcatctctcttttccctttttaattgaaatcgtgtttaagc |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42373054 |
accaaccactgtcgctcgctccactatatctgtttaaggtcagtttccgccccttgctatcatctctcttttccctttttaattgaaatcgtgtttaagc |
42372955 |
T |
|
| Q |
116 |
ttctcttcttcattttgcttattatg------attaattgttcgtactgaaattgccgattgaagttgattatgctgaaatttcaaaacctaatgagagc |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42372954 |
ttctcttcttcattttgcttattatgattatgattaattgttcatactgaaattgccgattgaagttgattatgctgaaatttcaaaacctaatgagagc |
42372855 |
T |
|
| Q |
210 |
cagctggaaaaac |
222 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
42372854 |
cagctagaaaaac |
42372842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 44 - 145
Target Start/End: Complemental strand, 8125 - 8024
Alignment:
| Q |
44 |
tctgtttaaggtcagtttccgccccttgctatcatctctcttttccctttttaattgaaatcgtgtttaagcttctcttcttcattttgcttattatgat |
143 |
Q |
| |
|
||||||||||| ||||||| ||||| |||| ||||||| | |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
8125 |
tctgtttaaggccagtttctgccccctgctctcatctcacctttccctttttaattgaaatcgtgtttaagtttctcttattcattttgcttattatgat |
8026 |
T |
|
| Q |
144 |
ta |
145 |
Q |
| |
|
|| |
|
|
| T |
8025 |
ta |
8024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University