View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_high_93 (Length: 236)
Name: NF6594_high_93
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_high_93 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 43961670 - 43961449
Alignment:
| Q |
1 |
aaaacaacattttgtagactctcaaaattttaaatgaagaggtttggtgttaaaaacacataaaaaattggtcaagaataaagttcaaggggattcactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43961670 |
aaaacaacattttgtagactctcaaaattttaaatgaagaggtttggtgttaaaaacacataaaaaattggtcaagaataaaattcaaggggattcactt |
43961571 |
T |
 |
| Q |
101 |
gaatccactagattggttgtggctctgcgaccggtttcttattgggattttgctgagatacaatatgcaagataaaagatgaagagtgacaatcactaca |
200 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43961570 |
gaatccactagattggttgtggctccgccaccggtttcttattggaattttgctgagatacaatatgcaagataaaagatgaagagtgacaatcagtaca |
43961471 |
T |
 |
| Q |
201 |
atgagaaagggggagttgaaaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43961470 |
atgagaaagggggagttgaaaa |
43961449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 106
Target Start/End: Original strand, 35492491 - 35492550
Alignment:
| Q |
48 |
tgttaaaaacacataaaaaattgg-tcaagaataaagttcaaggggattcacttgaatcc |
106 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| ||||| || ||||||||||||||||||| |
|
|
| T |
35492491 |
tgttaaaaacacattaaaaattggttcaaggataaaatttgaggggattcacttgaatcc |
35492550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 106
Target Start/End: Original strand, 35494477 - 35494536
Alignment:
| Q |
48 |
tgttaaaaacacataaaaaattgg-tcaagaataaagttcaaggggattcacttgaatcc |
106 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| ||||| || ||||||||||||||||||| |
|
|
| T |
35494477 |
tgttaaaaacacattaaaaattggttcaaggataaaatttgaggggattcacttgaatcc |
35494536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University