View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6594_high_97 (Length: 230)

Name: NF6594_high_97
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6594_high_97
NF6594_high_97
[»] chr4 (1 HSPs)
chr4 (159-215)||(36690838-36690894)


Alignment Details
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 159 - 215
Target Start/End: Original strand, 36690838 - 36690894
Alignment:
159 aatggtgtcattccacttgagtggaggaacaccaacctcggcacgataaggggatca 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36690838 aatggtgtcattccacttgagtggaggaacaccaacctcggcacgataaggggatca 36690894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University