View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_100 (Length: 234)
Name: NF6594_low_100
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_100 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 24260947 - 24261147
Alignment:
| Q |
17 |
agatagttatcggtgatcatgagtttataatgactgaatataatttacaagcaaactttgtttttctactcaatattatcttcattatttggcttggcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24260947 |
agatagttatcggtgatcatgagtttataatgactgaacataatttacaagcaaactttgtttttctactcaatattatcttcattatttggcttggcac |
24261046 |
T |
|
| Q |
117 |
aatattatctttattatttggcttggcaaaattgctattatcagtatacatgagtttcacacttaaattacattttcgtttaaatggatgcctcatgcaa |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
24261047 |
aatattatcttcattatttggcttggcaaaattgctattatcagtatacatgagtttcacacttaaattacatttccgtttaaatgtatgcctcatgcaa |
24261146 |
T |
|
| Q |
217 |
g |
217 |
Q |
| |
|
| |
|
|
| T |
24261147 |
g |
24261147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University