View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_101 (Length: 234)
Name: NF6594_low_101
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_101 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 234
Target Start/End: Original strand, 37858487 - 37858709
Alignment:
| Q |
12 |
acaaacatgtcacaatagctgatagcataaaaaatgaacattcaaggtactcccagaaataaagtcctttatattttatgcagctaaaaagctagtagat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37858487 |
acaaacatgtcacaatagctgatagcataaaaaatgaacattcaaggtactcccagaaataaagtcctttatattttatgcagctaaaaagctagtagat |
37858586 |
T |
 |
| Q |
112 |
atatacatgagtttaactatgcgtgtctaaggtaattaccactagttctttttgtatgagtgatttattttctctgtttannnnnnnatttcggcttatg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37858587 |
atatacatgagtttaactatgcgtgtctaaggtaattaccactagttctttttgtatgagtgatttattttctctgtttatttttttatttcggcttatg |
37858686 |
T |
 |
| Q |
212 |
caggttcgttgcccctagaattc |
234 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
37858687 |
caggttcgttgcccctcgaattc |
37858709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University