View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_108 (Length: 221)
Name: NF6594_low_108
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_108 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 205
Target Start/End: Original strand, 37594577 - 37594766
Alignment:
| Q |
16 |
tatgtgatgatgtctaacatatatgctgctgctggcaagtggaaggatgtcaataggatgagagttctgatgaaagagcaaggagttaagaaacaaacag |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37594577 |
tatgtgatgatgtctaacatatacgctgctgctggcaagtggaaggatgtcaataggatgagagttctgatgaaagagcaaggaattaagaaacaaacag |
37594676 |
T |
|
| Q |
116 |
cttatagttggatgcagattggaaacaaactccattgttttgttggaggagatccatcacatccaaatattgatgatattcatgatgctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37594677 |
cttatagttggatgcagattggaaacaaactccaatgttttgttggaggagatccatcacatccaaatattgatgatattcatgatgctt |
37594766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University