View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_110 (Length: 214)
Name: NF6594_low_110
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_110 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 46680725 - 46680524
Alignment:
| Q |
1 |
ttatgatggcatggaaaatgaaggaaatgattttgacttgaatgtaccatatgaaggcatagaaaatgaaataacttcttctggaaggcaaccggaactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46680725 |
ttatgatggcatggaaaatgaaggaaatgattttgacttgaatgtaccatatgaaggcatagaaaatgaaataacttcttctggaaggcaaccggaactg |
46680626 |
T |
|
| Q |
101 |
ccgaactgcgctgcttctttccatatttatgagagccaagggcatgagtcagatctaagtggggaggaagggacatgcaaaaactgtcactgtaagaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
46680625 |
ccgaactgcgctgcttctttccatatttatgagagccaagggcatgagtcagatctaagtggggaagaagggacatgcaaaaactgccactgtaagaaat |
46680526 |
T |
|
| Q |
201 |
tg |
202 |
Q |
| |
|
|| |
|
|
| T |
46680525 |
tg |
46680524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 22 - 70
Target Start/End: Complemental strand, 46680752 - 46680704
Alignment:
| Q |
22 |
aggaaatgattttgacttgaatgtaccatatgaaggcatagaaaatgaa |
70 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
46680752 |
aggaaatgattttgacttgaatgtaccttatgatggcatggaaaatgaa |
46680704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University