View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_115 (Length: 203)
Name: NF6594_low_115
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_115 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 185
Target Start/End: Complemental strand, 27672878 - 27672708
Alignment:
| Q |
15 |
caaagggcagaacataacacaatgacagttgaaaagaggtttgtgttggttgggattagaatagatagccatagcagacagcttctcaattgggctattg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27672878 |
caaagggcagaacataacacaatgacagttgaaaagaggtttgtgttggttgggattagaatagatagccatagcagacagcttctcaattgggctattg |
27672779 |
T |
|
| Q |
115 |
ttaaagttgctgaacctggtgattgtgttattgctgttcatgtagttaaaactaaaagctcaggtaaattt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27672778 |
ttaaagttgctgaacctggtgattgtgttattgctgttcatgtagttaaaactaaaagctcaggtaaattt |
27672708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 148
Target Start/End: Complemental strand, 55179910 - 55179794
Alignment:
| Q |
35 |
aatgacagttgaaaagaggtttgtgttggttgggattagaatagatagccat---agcagacagcttctcaattgggctattgttaaagttgctgaacct |
131 |
Q |
| |
|
||||||||| || |||| | ||| ||||| || |||||||| ||||| ||| ||||||||||| ||||| |||||||| | ||||||||| ||||| |
|
|
| T |
55179910 |
aatgacagtgaaagagagatgtgttttggtgggaattagaattgataggcatggcagcagacagctcctcaactgggctatagccaaagttgctcaacct |
55179811 |
T |
|
| Q |
132 |
ggtgattgtgttattgc |
148 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
55179810 |
cgtgattatgttattgc |
55179794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University