View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_40 (Length: 379)
Name: NF6594_low_40
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 117 - 369
Target Start/End: Original strand, 49995422 - 49995672
Alignment:
| Q |
117 |
tgtgcatagtatttcaggattgtattaaaattacagctcaaacaaggtctatatgtattaaaaactatggctacagcccaaaggcatgaactacnnnnnn |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49995422 |
tgtgcatagtatttcaggattgtattaaaattacagctcaaacaaggtctat--gtattaaaaactatggctacagcccaaaggcatgaactacaaaaaa |
49995519 |
T |
 |
| Q |
217 |
ngagggaaagaaactggaaacctttgaatgctcttctaccaatgcgtcaaaattcaaaatgtccttccatgaatgccatcagaagctgcaatcataatca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49995520 |
agagggaaagaaactggaaacctttgaatgctcttctaccaatgcgtcaaaattcaaaatgcccttccatgaatgccatcagaagctgcaatcataatca |
49995619 |
T |
 |
| Q |
317 |
ttgttagcactaacttcatccaaatgacctctgtagcaacggcactgatgatg |
369 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
49995620 |
ttgttagcaataacttcatccaaatgacctctgtagcaatggcacttatgatg |
49995672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University