View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_56 (Length: 304)
Name: NF6594_low_56
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_56 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 304
Target Start/End: Complemental strand, 40255231 - 40254944
Alignment:
| Q |
17 |
tgctacactcaaagaagttggaacaacactttccttatcataaatattgttagataaataattctccttgttgatgctatgaagtgaaaggctagaggaa |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40255231 |
tgctaaactcaaagaagttggaacaacactttccttatcataaatattgttagataaataattctccttgttgatgctatgaagtgaaaggctagaggaa |
40255132 |
T |
 |
| Q |
117 |
gcaacatcatcaatatttgcatttactattccaaatttgttttgatgaannnnnnnnnnnnnnaaggccatgttgcatgattcaactattcttgtgttag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40255131 |
gcaacatcatcaatatttgcatttactattccaaatttgttttgatgaattttttgcttttttaaggccatgttgcatgattcaactattcttgtgttag |
40255032 |
T |
 |
| Q |
217 |
atgaattcattgaggaaattttcttctcattatttgattggaggctagacacagataaatcacatgaatgttgttgctttggatgatc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40255031 |
atgaattcattgaggaaattttcttctcattatttgattggaggctagacaaagataaatcacatgaaagttgttgctttggatgatc |
40254944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University