View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6594_low_63 (Length: 277)

Name: NF6594_low_63
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6594_low_63
NF6594_low_63
[»] chr1 (1 HSPs)
chr1 (14-277)||(8458308-8458571)


Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 14 - 277
Target Start/End: Complemental strand, 8458571 - 8458308
Alignment:
14 accttattaatcagtaacctttaaacctaaatatcccttctattccttaatatttcaattcacatagcaaaatttatttccaaatgcaaaattaatttta 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8458571 accttattaatcagtaacctttaaacctaaatatcccttctattccttaatatttcaattcacatagcaaaatttatttccaaatgcaaaattaatttta 8458472  T
114 cataaatcaattataccataaccaggcttgtagtttccatacgaaataagaaaaatgcatataaatttgcgctgaccatacacacccccacttgagcatg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
8458471 cataaatcaattataccataaccaggcttgtagtttccatacgaaataagaaaaatgcatataaagttgcgctgaccatacacacccccacttgagcatg 8458372  T
214 tatttcagtgtgttattttgagaaatagtgaactaagaacctgagttgagccagtatcatgatt 277  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
8458371 tatttcagtgtgttattttgagaaatagtgaactaaaaacctgagttgagccagtatcatgatt 8458308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University