View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_68 (Length: 267)
Name: NF6594_low_68
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 93 - 256
Target Start/End: Original strand, 38422897 - 38423060
Alignment:
| Q |
93 |
tttctaccgcatcactttagatgagattcacaatgttcttgaggagtttaaacacacatataatttctattggtaatctataataaaaaatagcttacaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38422897 |
tttctaccgcatcactttagatgagattcacaatgtttttgaggagtttaaacacacatataatttctattggtaatctataaaaaaaaatagcttacaa |
38422996 |
T |
 |
| Q |
193 |
ttacttggacaatttttattattaaactattgttaacgtgaataaaattattcatatcacctat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38422997 |
ttacttggacaatttttattattaaactattgttaacgtgaataaaattattcatatcacctat |
38423060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University