View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_74 (Length: 254)
Name: NF6594_low_74
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_74 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 38197371 - 38197138
Alignment:
| Q |
1 |
agtgtcggaaggtatgggaaacaggaagtatttgggcatgccatccatggtggggcgcgtaacaagaaagcaatttttggatatctgagagacaaagttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
38197371 |
agtgtcggaaggtatgggaaacaggaagtatttgggcatgccatccatggtggggcgcgtaacaagaaatcaatttttggatatctgagagacatagttt |
38197272 |
T |
 |
| Q |
101 |
ggaggaaaatacaacaatggtcgagtaagcatttatccaaagcaggaagagaagtgttaattaaatcagttgcacagtccattcctacatattgtatgag |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38197271 |
ggaggaaaatacaacaatggtcgggtaagcatttatccaaagcaggaagagaagtgttaattaaatcagttgcacagtccattcctacatattgtatgag |
38197172 |
T |
 |
| Q |
201 |
cacttttctgttaccaacttctttgggggaggaa |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
38197171 |
cacttttctgttaccaactactttgggggaggaa |
38197138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 104 - 206
Target Start/End: Original strand, 25499449 - 25499551
Alignment:
| Q |
104 |
ggaaaatacaacaatggtcgagtaagcatttatccaaagcaggaagagaagtgttaattaaatcagttgcacagtccattcctacatattgtatgagcac |
203 |
Q |
| |
|
||||||||||||||||||| || || ||| | || |||||||||||||| || || || |||||||| ||||| || ||||| |||||||| |||| ||| |
|
|
| T |
25499449 |
ggaaaatacaacaatggtctagaaaacatctctcgaaagcaggaagagaggtcttgatcaaatcagtggcacaatcaattcccacatattgcatgaccac |
25499548 |
T |
 |
| Q |
204 |
ttt |
206 |
Q |
| |
|
||| |
|
|
| T |
25499549 |
ttt |
25499551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University