View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_77 (Length: 251)
Name: NF6594_low_77
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_77 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 26 - 251
Target Start/End: Original strand, 29201546 - 29201770
Alignment:
| Q |
26 |
tatttagtcttaactttgtattaaatatatcaacttttatcaacatatttctgtttataaataagaacgaagagagtacttaatataaaaatgatgtgtg |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29201546 |
tatttagtcttaactttgtattaaatatatcaatttttatcaacatatttctgtttataaataagaacgaagagagtacttaatataaaaatgatgtgtc |
29201645 |
T |
|
| Q |
126 |
aatgtctttgaagggtccgaacataactagttagcagttacttctgccactccctgggaccacccaacataatgataaatgtggctgcatcctttttatt |
225 |
Q |
| |
|
||||| ||||| ||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29201646 |
aatgt-tttgatgggtcgagacataactagttagtggttccttctgccactccctgggaccacccaacataatgataaatgtggctgcatcctttttatt |
29201744 |
T |
|
| Q |
226 |
attagtcatttttaacttctgaaata |
251 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29201745 |
attagtcatttttaacttctgaaata |
29201770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University