View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_79 (Length: 251)
Name: NF6594_low_79
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_79 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 33788557 - 33788315
Alignment:
| Q |
1 |
tgtctaagttaacagaagcagaaggtgatcaaattgaatctattcctccaaaatcgacttccttgaagattaagcttaaaagcgtggccaaccaagaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33788557 |
tgtctaagttaacagaagcagaaggtgatcaaattgaatctattcctccaaaatcgacttccttgaagattaagcttaaaagcgtggccaaccaagaaaa |
33788458 |
T |
|
| Q |
101 |
gagagtgaagttctctgaggacttgaatctcccagccctagctgaaaatgaaagcaagaaagattgtaatcctatctggttctccttggttgcttccaaa |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33788457 |
gagagtaaagttctctgaggacttgaatctcccagccctagctgaaaatgaaagcaagaaagattgtaatcctatctggttctccttggttgcttccaaa |
33788358 |
T |
|
| Q |
201 |
gagcagtaagattacttttcatggcttgttattatttcatctc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33788357 |
gagcagtaagattacttttcatggcttgttattatttcatctc |
33788315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University