View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_87 (Length: 242)
Name: NF6594_low_87
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 53614409 - 53614632
Alignment:
| Q |
1 |
ttcatatgcacaaataggcttataatctgtttgaaaccactcatcatcaataatacccgaaatagttatccgctgtgagagatttggaaggaagtcaaac |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53614409 |
ttcatacgcacaaataggcttataatctgtttgaaaccactcatcatcaataatacccgaaatagttatccgctgtgagagatttggaaggaagtcaaac |
53614508 |
T |
 |
| Q |
101 |
aaattagtaactatcaattacacttttaagtttaagcacagtgcaatagtttttgaatttctacctttccaggatgcggttcaagtattttcgcaattag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53614509 |
aaattagtaactatcaattacacttttaagtttaagcacagtgcaatagttcttgaatttctacctttccaggatgcggttcaagtattttcgcaattag |
53614608 |
T |
 |
| Q |
201 |
tttcttttgactttgagtaaacca |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
53614609 |
tttcttttgactttgagtaaacca |
53614632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University