View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_88 (Length: 241)
Name: NF6594_low_88
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_88 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 180
Target Start/End: Original strand, 30375241 - 30375398
Alignment:
| Q |
18 |
ccaccaactattgttgtcaatttcatgatgtctagtaagatgccggttcctcttgttctgtttgaattttgaatgatttatcgagtaagcgaattttctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30375241 |
ccaccaactattgttgtcaatttcatgatgtctactaagatgccggttcctcttgttctgtttgaattttgaatgatttatcgagtaagcgaattttctt |
30375340 |
T |
 |
| Q |
118 |
caaattagtgagactatgtcatgtcatgtcacactcgaactatcaatgacacactgctgcttc |
180 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
30375341 |
caaattagtgagact-----atgtcatgtcacactcgaactattaatgatacactgctgcttc |
30375398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University