View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6594_low_91 (Length: 239)
Name: NF6594_low_91
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6594_low_91 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 29202121 - 29201900
Alignment:
| Q |
18 |
tcttgtacattttctagtttctagtattaatactaaaagttggaagattcgtttgtgtggaatgcgttgttgtatgggtacatgtgagggaatttcggtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29202121 |
tcttgtacattttctagtttctagtattaatactaaaagttggaagattcgtttgtgtggaatgcgttgttgtatgggtacatgtgagggaatttcggtc |
29202022 |
T |
|
| Q |
118 |
tccattcaaaatgcaccaacttggtccaaaaacgggaatttgatcgattgagttgcaaaaacatgtttttctttgtgttctgattggttggtataacact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29202021 |
tccattcaaaatgcaccaacttggtccaaaaacgggaatttgatcaattgagttgcaaaaacatgtttttctttgtgttctgattggttggtataacagt |
29201922 |
T |
|
| Q |
218 |
ctcactttcacatctaaacatt |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29201921 |
ttcactttcacatctaaacatt |
29201900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 29198453 - 29198407
Alignment:
| Q |
169 |
gttgcaaaaacatgtttttctttgtgttctgattggttggtataaca |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
29198453 |
gttgcaaaaacatgtttttctttgagttctgattggttactataaca |
29198407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University