View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6594_low_95 (Length: 238)

Name: NF6594_low_95
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6594_low_95
NF6594_low_95
[»] chr2 (1 HSPs)
chr2 (20-226)||(45313573-45313774)
[»] chr3 (2 HSPs)
chr3 (131-191)||(54631733-54631793)
chr3 (20-61)||(54631688-54631729)


Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 45313774 - 45313573
Alignment:
20 ctgaggatattaacatgattgatgttgagggaaataagtcaagtcaagtcaagaggaggagattatggaaatttctagaatgcgcaagggtccggtgttg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||    
45313774 ctgaggatattaacatgattgatgttgagggaaataagtcaagtcaag-----aggaggagattatggaaatttctagaatgcgcaagggtccggtgttg 45313680  T
120 gatttgatgccgctcttctttcgagaaagaaactgcaaatgaaagggggtccagggaggataaggagaaggagacggttactgtttttgatattaaccta 219  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
45313679 gatttgatgccgctcttctttcgagaaagcaactgcaaatgaaagggggtccggggaggataaggagaaggagacggttactgtttttgatattaaccta 45313580  T
220 tgatgat 226  Q
    |||||||    
45313579 tgatgat 45313573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 131 - 191
Target Start/End: Original strand, 54631733 - 54631793
Alignment:
131 gctcttctttcgagaaagaaactgcaaatgaaagggggtccagggaggataaggagaagga 191  Q
    ||||||||||||||||||  ||||||||||||||||||||  ||||||||||||| |||||    
54631733 gctcttctttcgagaaagcgactgcaaatgaaagggggtctggggaggataaggataagga 54631793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 54631688 - 54631729
Alignment:
20 ctgaggatattaacatgattgatgttgagggaaataagtcaa 61  Q
    |||||||| |||||||| |||||||||||||||| |||||||    
54631688 ctgaggatgttaacatggttgatgttgagggaaacaagtcaa 54631729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University