View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6594_low_97 (Length: 237)

Name: NF6594_low_97
Description: NF6594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6594_low_97
NF6594_low_97
[»] chr7 (1 HSPs)
chr7 (16-222)||(42372842-42373054)
[»] scaffold0262 (1 HSPs)
scaffold0262 (44-145)||(8024-8125)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 42373054 - 42372842
Alignment:
16 accaatcactgtcgctcgctccactatatctgtttaaggtcagtttccgccccttgctatcatctctcttttccctttttaattgaaatcgtgtttaagc 115  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42373054 accaaccactgtcgctcgctccactatatctgtttaaggtcagtttccgccccttgctatcatctctcttttccctttttaattgaaatcgtgtttaagc 42372955  T
116 ttctcttcttcattttgcttattatg------attaattgttcgtactgaaattgccgattgaagttgattatgctgaaatttcaaaacctaatgagagc 209  Q
    ||||||||||||||||||||||||||      ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42372954 ttctcttcttcattttgcttattatgattatgattaattgttcatactgaaattgccgattgaagttgattatgctgaaatttcaaaacctaatgagagc 42372855  T
210 cagctggaaaaac 222  Q
    ||||| |||||||    
42372854 cagctagaaaaac 42372842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0262 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: scaffold0262
Description:

Target: scaffold0262; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 44 - 145
Target Start/End: Complemental strand, 8125 - 8024
Alignment:
44 tctgtttaaggtcagtttccgccccttgctatcatctctcttttccctttttaattgaaatcgtgtttaagcttctcttcttcattttgcttattatgat 143  Q
    ||||||||||| ||||||| ||||| |||| ||||||| | |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||    
8125 tctgtttaaggccagtttctgccccctgctctcatctcacctttccctttttaattgaaatcgtgtttaagtttctcttattcattttgcttattatgat 8026  T
144 ta 145  Q
    ||    
8025 ta 8024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University