View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6595_high_16 (Length: 251)
Name: NF6595_high_16
Description: NF6595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6595_high_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 5377096 - 5376853
Alignment:
| Q |
8 |
gattatactcttcacttaaatgctatatatacatggttgttgtagttgttgtacttactgagcaatttgcaattacatttcacacattactttgtttcca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5377096 |
gattatactcttcacttaaatgctatatatacatggttgttgtagttgttgtacttactgagcaatttgcaattacatttcacacattactttgtttcca |
5376997 |
T |
 |
| Q |
108 |
tgttttaaaattgaaattgcaatttgaaatggaaaaatcttttgattcgttgctgctgttgttcctggtatagaggcatggatgtttaaggttcgggttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5376996 |
tgttttaaaattgaaattgcaatttgaaatggaaaaatcttttgattcgttgctgctgttgttcctggtatagaggcatggatgtttaaggttcgggttt |
5376897 |
T |
 |
| Q |
208 |
gggcagtcccaacttttttgaaggctgatcaaccaaactctatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5376896 |
gggcagtcccaacttttttgaaggctgatcaaccaaactctatt |
5376853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University