View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6595_high_8 (Length: 377)
Name: NF6595_high_8
Description: NF6595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6595_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 16 - 366
Target Start/End: Original strand, 47428026 - 47428376
Alignment:
| Q |
16 |
gtaacttcaccaatccctttaaagcatgcaatgctctccttgcctgcaaattttgtatgtatgttatagcataaactttgtatcacatacacttgagatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47428026 |
gtaacttcaccaatccctttaaagcatgcaatgctctccttgcctgcaaattttgtatgtatgttatagcataaactttgtatcacatacacttgagatc |
47428125 |
T |
|
| Q |
116 |
gagaagacatgtccggtgtgtgacaccaacacatgcgatcacattttttaaaatgtaatgaaatatagagagaagtttataccaagtaggagcgaaagga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47428126 |
gagaagacatgtccggtgtgtgacaccaacacatgcgatcacattttttaaaatgtaatgaaatatagagagaagtttataccaagtaggagcgaaagga |
47428225 |
T |
|
| Q |
216 |
agcttgaatcttcgtagcagcttttttcacaaattcagaagctgttggacgaaaccttggggactgagtatagaacaggccttgtatttgtaatttttga |
315 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47428226 |
agcttgaatctttgtagcagcttttttcacaaattcagcagctgttggacgaaaccttggggactgagtatagaacaggccttgtatttgtaattttgga |
47428325 |
T |
|
| Q |
316 |
gagtcatctgaatcaaaagacttggaaattttatgagctactaacttgccc |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47428326 |
gagtcatctgaatcaaaagacttggaaattttatgagctactaccttgccc |
47428376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University