View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6596_low_6 (Length: 319)
Name: NF6596_low_6
Description: NF6596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6596_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 17 - 311
Target Start/End: Original strand, 27972262 - 27972556
Alignment:
| Q |
17 |
acaatccatctctgaaatagatagaatcttcgttttcatttgatgaaagtgagactgataatatatcaaccccatctgcaattgcatcatcaaatgcggc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27972262 |
acaatccatctctgaaatagatagaatcttcgttttcatttgatgaaagtgagactgataatatatcaaccccatctgcaattgcatcatcaaatgcggc |
27972361 |
T |
 |
| Q |
117 |
gagaatatttgcatcgcagcagtgtttagaccaacacgctttatagacagcaacgcgtgcagatggaactcctcctcttgttgttccttgtgcaagacct |
216 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27972362 |
gagaatatttgcatcgtagcagtgtttagaccaacacactttatacacagcaacgcgtgcagatggaactcctcctcttattgttccttgtgcaagacct |
27972461 |
T |
 |
| Q |
217 |
agcatgctcgccatgctaacaaggttcccagctgcaattgatgctgtgtgagttccgtggccatttgaatcccttggtgaatcaagatattcttc |
311 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27972462 |
agcatgctcaccatgctaacaaggttcccatctgcaattgatgctgtgtgagttccatggccatttgaatcccttggtgaatcaagatattcttc |
27972556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 283
Target Start/End: Complemental strand, 34823050 - 34822957
Alignment:
| Q |
190 |
cctcttgttgttccttgtgcaagacctagcatgctcgccatgctaacaaggttcccagctgcaattgatgctgtgtgagttccgtggccatttg |
283 |
Q |
| |
|
||||||||||| ||||| | ||||| | ||| || ||||||||||| ||||||||||| || ||||||| ||| ||||| || || ||||||| |
|
|
| T |
34823050 |
cctcttgttgtcccttggcctagacccaacatacttgccatgctaactaggttcccagccgctattgatgatgtatgagtcccatgtccatttg |
34822957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 122
Target Start/End: Complemental strand, 34823175 - 34823119
Alignment:
| Q |
66 |
tgagactgataatatatcaaccccatctgcaattgcatcatcaaatgcggcgagaat |
122 |
Q |
| |
|
||||| ||||| ||| ||||||| ||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
34823175 |
tgagattgatattatgtcaaccctatcagcaatggcatcatcaaatgcggcaagaat |
34823119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University