View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6597_high_17 (Length: 381)
Name: NF6597_high_17
Description: NF6597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6597_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 19 - 362
Target Start/End: Original strand, 56278230 - 56278576
Alignment:
| Q |
19 |
ggagagtgatgatacaaatccttggatgaatcctcttggcttcaaagatgggaaattgctgattaaggtttctgcagagttatacatctatgacatgaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56278230 |
ggagagtgatgatacaaatccttggatgaatcctcttggcttcaaagatgggaaattgctgattaaggtttctgcagagttatacatctatgacatgaag |
56278329 |
T |
 |
| Q |
119 |
aatcacaagattgctcatgcttgttcctttctacaactcaacccacaatccttgtcgcatcctacagtatttcctcattccttgactttggtttccctaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56278330 |
aatcacaagattgctcatgcttgttcctttctacaactcaacccacaatccttgtcgcatcctacagtatttcctcattccttgactttggtttccctaa |
56278429 |
T |
 |
| Q |
219 |
aagatccttagtatagaactaacgcctatatattagcttttattatcggattatcaccgaatgttttgggaccattttagtttatatatatgtagaaact |
318 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
56278430 |
aagatccttagtatagaactaactcctatatattagcttttattatcggattatcaccgaatgttttggga-tattttagtttatatatatgtagaaact |
56278528 |
T |
 |
| Q |
319 |
aagttgcctggaagg----ttccttccttccattccatagctgtggaa |
362 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
56278529 |
aagttgcctggaaggttccttccttccttccattccatagctgtggaa |
56278576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University