View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6597_high_26 (Length: 288)
Name: NF6597_high_26
Description: NF6597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6597_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 10 - 274
Target Start/End: Original strand, 34036223 - 34036487
Alignment:
| Q |
10 |
aagaatattagtagtaacttctaaactcgtgtaaggggataaaggatttgttttggattttacataggttttggactttgatttgaagggttagattcaa |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34036223 |
aagaaaattagtagtaacttctaaactcgtgtaaggggataaaggatttgttttggattttacatagggtttggactttgatttgaagggttagattcaa |
34036322 |
T |
 |
| Q |
110 |
agtttatcgatcgaggtttttcagagttggatttctaattctatgtgctaatttgcttcctaaaaaatatctcaatgttttctttcatatgtggtccatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34036323 |
agtttatcgatcgaggtttttcagagttggatttctaattctatgtgctaatttgcttcctaaaaaatatctcaatgttttctttcatatgtggtccatg |
34036422 |
T |
 |
| Q |
210 |
ttgaacccgtgaatgaatattgcctaaaaaaccagctatgattaatgatgctctatagaagtaga |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34036423 |
ttgaacccgtgaatgaatattgcctaaaaaaccagctatgattaatgatgctctatagaagtaga |
34036487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University