View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6597_high_30 (Length: 239)

Name: NF6597_high_30
Description: NF6597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6597_high_30
NF6597_high_30
[»] chr2 (2 HSPs)
chr2 (122-239)||(12191484-12191599)
chr2 (18-59)||(12191380-12191421)


Alignment Details
Target: chr2 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 239
Target Start/End: Original strand, 12191484 - 12191599
Alignment:
122 ggattatgcgcaactgcgatgattaatcatttaaattttgcatgtttaattatttaaatgatgattaatcttcaaatgaaatcaaaaattttataacttg 221  Q
    |||||| ||||||||  | ||||||||||||||||||||    |||||||| ||||||||||||||||||||| ||  ||||||||| |||||| | |||    
12191484 ggattacgcgcaactatggtgattaatcatttaaattttaggcgtttaattgtttaaatgatgattaatcttc-aacaaaatcaaaatttttat-atttg 12191581  T
222 attaagttgaatatcttt 239  Q
    ||||||||||||||||||    
12191582 attaagttgaatatcttt 12191599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 12191380 - 12191421
Alignment:
18 tgtataaaggttatagtgaagtgagactctcgccgagactca 59  Q
    ||||||||||||||||||||||||||||||||||||||||||    
12191380 tgtataaaggttatagtgaagtgagactctcgccgagactca 12191421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University