View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6597_low_29 (Length: 282)
Name: NF6597_low_29
Description: NF6597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6597_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 61 - 272
Target Start/End: Complemental strand, 43468929 - 43468721
Alignment:
| Q |
61 |
aatggtggttatcgaaatgagtcaatcttacaagactaaacattattttaaatgggtcttgattttttaatagtataacacttgataatgtttatttgct |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43468929 |
aatggtggttatcgaaatgagtcaatcttacaagactaaacattattttaaatgggtcttgattttttaattgtataacacttgataatgtttatttgct |
43468830 |
T |
 |
| Q |
161 |
tgatacggatcctttttcttttatcctatcttataaaacttttttgatggcttaatttaccaccataaggcttactttactataagattttaaaataact |
260 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43468829 |
tgatacggaccctttttcttttatcctatcttataaaacttttttgacggcttaattt---accataaggcttactttactataagattttaaaataact |
43468733 |
T |
 |
| Q |
261 |
aagagccctatg |
272 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43468732 |
aagagccctatg |
43468721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 43468987 - 43468948
Alignment:
| Q |
19 |
gatttcttaagttttttaaaaccatcataagttctgttta |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43468987 |
gatttcttaagttttttaaaaccatcataagttctgttta |
43468948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University