View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6597_low_31 (Length: 239)
Name: NF6597_low_31
Description: NF6597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6597_low_31 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 239
Target Start/End: Original strand, 12191484 - 12191599
Alignment:
| Q |
122 |
ggattatgcgcaactgcgatgattaatcatttaaattttgcatgtttaattatttaaatgatgattaatcttcaaatgaaatcaaaaattttataacttg |
221 |
Q |
| |
|
|||||| |||||||| | |||||||||||||||||||| |||||||| ||||||||||||||||||||| || ||||||||| |||||| | ||| |
|
|
| T |
12191484 |
ggattacgcgcaactatggtgattaatcatttaaattttaggcgtttaattgtttaaatgatgattaatcttc-aacaaaatcaaaatttttat-atttg |
12191581 |
T |
|
| Q |
222 |
attaagttgaatatcttt |
239 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12191582 |
attaagttgaatatcttt |
12191599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 12191380 - 12191421
Alignment:
| Q |
18 |
tgtataaaggttatagtgaagtgagactctcgccgagactca |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12191380 |
tgtataaaggttatagtgaagtgagactctcgccgagactca |
12191421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University